New quality control strain for use in routine testing for production of extended-spectrum Beta-lactamases by enterobacteriaceae.

نویسندگان

  • Joel E Mortensen
  • Mavi Bernier
  • Larry D Gray
  • Sharon Dolan
  • Nancy D Hanson
  • Ellen S Moland
  • Baha Abdalhamid
چکیده

The Clinical and Laboratory Standards Institute (CLSI) guidelines for the detection of extended-spectrum -lactamases (ESBL) produced by Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, and Proteus mirabilis recommend the use of K. pneumoniae ATCC 700603 (an ESBL producer) as a quality control organism in tests to detect ESBL (1). A clinical isolate of Proteus mirabilis was studied to determine whether this isolate could be an alternative quality control organism in these tests. This isolate has been accepted by the American Type Culture Collection and is designated Proteus mirabilis ATCC BAA-856. The Etest (AB Biodisk, Solna, Sweden) and disk diffusion tests were performed in accordance with the manufacturer’s instructions and CLSI recommendations, respectively (1). Ceftazidime, ceftazidime-clavulanic acid, cefotaxime, and cefotaxime-clavulanic acid were used in both susceptibility methods. Reproducibility of ESBL production by BAA-856 was studied by performing both susceptibility methods five times on each of four different days for a total of 20 replicates for both susceptibility methods. The stability of ESBL expression was studied by subculturing BAA-856 20 consecutive times on solid 5% sheep blood medium. Colonies from passes 1, 5, 10, 15, and 20 were tested in duplicate by both susceptibility methods. The modal MICs (range) for the Etest system were the following: for cefotaxime, 0.75 g/ml (0.5 to 1.0 g/ml), and for cefotaxime-clavulanic acid, 0.032 g/ml (0.032 to 0.05 g/ml). All 20 replicate MICs for ceftazidime and ceftazidime-clavulanic acid were 32 and 0.125 g/ml, respectively. All MICs ( 1 dilution) were stable throughout 20 passages. Use of the disk diffusion procedure to determine reproducibility of ESBL production yielded the following modal zone diameters (range): for cefotaxime, 28 mm (26 to 29 mm); for cefotaximeclavulanic acid, 35 mm (32 to 36 mm); for ceftazidime, 17 mm (15 to 19 mm); and for ceftazidime-clavulanic acid, 30 mm (26 to 31 mm). The mean difference (range) between cefotaxime and cefotaxime-clavulanic acid was 5.7 mm (5 to 8 mm), and the mean difference between ceftazidime and ceftazidime-clavulanic acid was 11.4 mm (10 to 14 mm). Zone diameters showed consistency ( 2 mm) throughout 20 passages. Crude sonic extracts of BAA-856 were analyzed by analytical isoelectric focusing (IEF) in ampholine polyacrylamide gels (pH range, 3.5 to 9.5) on a Multiphor IEF apparatus (LKB, Rockville, MD). The following characteristics of ESBL produced by BAA-856 were determined: isoelectric points (pIs), ability to hydrolyze cefotaxime, and ability to be inhibited by clavulanic acid (2, 3). IEF lanes were overlaid with solutions of lithium clavulanate (1,000 M), and ESBL bands were visualized by overlaying the IEF gel with a thin layer of nitrocefin agar which contained cefotaxime (0.75 g/ml). Organisms with known -lactamases (TEM-1, -2, and -3 and SHV-2, -3, -4, and -5) were used as IEF control standards. BAA-856 produced two -lactamases with separate pIs of 5.6 and 8.0; both enzymes were inhibited by lithium clavulanate. The fact that only the pI 5.6 enzyme hydrolyzed cefotaxime suggested the presence of a TEM-ESBL. DNA templates for PCR were prepared as previously described (2). Primers TEM15F (TCGGGGAAATGTGCG) and TEMENDM (CGTTCCACTGAGCGTCAGAC) were used. A 3100-Avant genetic analyzer (ABI, Foster City, CA) was used for automated-cycle sequencing. BLASTn analysis identified the gene as blaTEM-10 and the corresponding enzyme as TEM-10. The results of these studies suggest that BAA-856 produces a stable TEM-10 ESBL and that BAA-856 can be an acceptable isolate to use in tests to detect the production of ESBL.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Prevalence of Multiple Drug Resistant Clinical Isolates of Extended-Spectrum Beta-Lactamase Producing Enterobacteriaceae in Southeast Iran

Background: Multidrug resistance and production of extended spectrum β-lactamases (ESBLs) by enteric gram-negative rods in hospitals and community continue to be worsened. We aimed to characterize the multidrug resistance and determine the prevalence of ESBL production by clinical isolates of Enterobacteriaceae in southeast Iran. Methods: Gram-negative bacteria isolated from clinical samples of...

متن کامل

Prevalence of Extended-Spectrum Beta-Lactamases Enzymes in Enterobacter Aerogenes Isolated from Urinary Tract Infections in Shahrekord City

Introduction: Enterobacteriaceae produce the Extended-Spectrum Beta-Lactamases which is considered as an important resistant mechanism of beta-lactam antibiotics. The resistance to beta-lactam antibiotics is the main problem in the bacterial infections therapy. The prevalence of these enzymes changes in different geographical areas and with time. The present study aims to explore the frequency ...

متن کامل

ترکیب آنتی‌بیوتیک‌های بتالاکتام و مهارکننده بتالاکتاماز علیه سویه‌های انتروباکتریاسه تولیدکننده بتالاکتاماز با طیف وسیع

In the last decades, Extended-Spectrum-β-Lactamases (ESBLs) in gram negative bacilli have appeared as a significant mechanism of resistance to antibiotics. Although resistance to carbapenems is increasing among bacteria, they are still the treatment of choice for serious infections caused by ESBL producers. Therefore, the aim of the present study was to evaluate the effect of ß-lacta...

متن کامل

Broad-Spectrum Beta-Lactamases and Drug-Resistance Phenotypes of Enterobacteriaceae Isolated from Clinical Specimens in Gonbad-e Kavus, Golestan Province, Iran

Introduction: This study aimed to determine the frequency of extended-spectrum beta-lactamases (ESBL) and different drug resistance phenotypes in Enterobacteriaceae isolated from clinical specimens in Gonbad-e Kavus, Golestan Province. Methods: 220 clinical samples of urine, blood, pus, sputum, CSF, body fluids, and ear and eye discharge were collected during six months from April to September ...

متن کامل

Occurrence and characteristics of extended spectrum beta-lactamases-producing Enterobacteriaceae from foods of animal origin

Presence of extended spectrum beta-lactamases (ESBL) in bacteria is a growing health concern of global significance. The local, regional, national, and international epidemiological studies for extended spectrum beta-lactamases-producing Enterobacteriaceae and their encoding genes in foods are still incomplete. The objective of this study was to determine the occurrence of extended spectrum bet...

متن کامل

Frequency of extended spectrum beta lactamase producer P. aeruginosa strains isolated from burned patients of Motahari hospital, Teharan, Iran

Pseudomonas aeruginosa is an opportunistic pathogen which is naturally resistant to a large range of antibiotics like lots of Beta–Lactams (penicillins, cephalosporins and carbapenems) and may cause additional resistance after unsuccessful treatment. The understanding of beta-lactamase identification and detection in these bacteria is very valuable. In recent years a number of variety of new be...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Journal of clinical microbiology

دوره 43 5  شماره 

صفحات  -

تاریخ انتشار 2005